Stem-loop sequence cli-mir-1329

AccessionMI0030063 (change log)
DescriptionColumba livia miR-1329 stem-loop
Stem-loop
   --g  u   ug   a    ca               u  auuucuc 
5'    uc ggu  uag gaua  gugaucagguuacga gg       a
      || |||  ||| ||||  ||||||||||||||| ||        
3'    ag uca  auc cuau  cacuaguucgaugcu cc       a
   aag  u   gu   c    ag               -  aacaaug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375528.1: 20717993-20718083 [+]
intergenic
Database links

Mature sequence cli-miR-1329-5p

Accession MIMAT0038672
Sequence

16 - 

uacagugaucagguuacgaugga

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-1329-3p

Accession MIMAT0038673
Sequence

55 - 

cucguagcuugaucacgauauc

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).