Stem-loop sequence cli-mir-551a

AccessionMI0030057 (change log)
DescriptionColumba livia miR-551a stem-loop
Stem-loop
     g    u      g            a  u ga    g   ca 
5' cu ugcg gaccuu gaaaucaagugu gg g  gccu ugg  g
   || |||| |||||| |||||||||||| || |  |||| |||   
3' gg acgc cuggga cuuugguucaca cc c  cgga acu  c
     g    -      a            -  - ag    -   ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB376210.1: 3837047-3837132 [-]
intergenic
Database links

Mature sequence cli-miR-551a-5p

Accession MIMAT0038662
Sequence

16 - 

gaaaucaaguguagguggagccu

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-551a-3p

Accession MIMAT0038663
Sequence

54 - 

gcgacccacacuugguuucaa

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).