Stem-loop sequence cli-mir-489

AccessionMI0030054 (change log)
DescriptionColumba livia miR-489 stem-loop
Stem-loop
   -   ---    ug             c      ua     a 
5'  ggc   uugg  gucguauguauga gucauu  cuugg c
    |||   ||||  ||||||||||||| ||||||  |||||  
3'  ucg   aauc  cggcauguauacu caguga  ggauu u
   g   uca    gu             a      --     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375449.1: 1811709-1811786 [+]
intergenic
Database links

Mature sequence cli-miR-489-5p

Accession MIMAT0038656
Sequence

8 - 

uggucguauguaugacgucauu

 - 29

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-489-3p

Accession MIMAT0038657
Sequence

48 - 

ugacaucauauguacggcugcu

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).