Stem-loop sequence cli-mir-459

AccessionMI0030051 (change log)
DescriptionColumba livia miR-459 stem-loop
Stem-loop
   -uuagguu       c   a          a        ucug 
5'         uugcacu agu acaaggauuc uccucguu    g
           ||||||| ||| |||||||||| ||||||||     
3'         aacguga uca uguuucuaag aggggcaa    c
   cgauaauu       a   c          -        uaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375804.1: 3576168-3576253 [-]
intergenic
Database links

Mature sequence cli-miR-459-5p

Accession MIMAT0038651
Sequence

14 - 

ucaguaacaaggauucauccu

 - 34

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).