Stem-loop sequence cli-mir-375

AccessionMI0030038 (change log)
DescriptionColumba livia miR-375 stem-loop
Stem-loop
   --------       u      cc   u       c ga 
5'         ccuggcg cgagcc  acg gcaagac u  c
           ||||||| ||||||  ||| ||||||| |  c
3'         ggauugc gcucgg  ugc uguuuug a  u
   accuggac       -      cu   u       c ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375305.1: 1406265-1406336 [-]
intergenic
Database links

Mature sequence cli-miR-375-5p

Accession MIMAT0038628
Sequence

5 - 

gcgucgagccccacgugcaagac

 - 27

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-375-3p

Accession MIMAT0038629
Sequence

41 - 

uuuguucguucggcucgcguua

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).