Stem-loop sequence cli-mir-367

AccessionMI0030037 (change log)
DescriptionColumba livia miR-367 stem-loop
Stem-loop
   a  -   a            ua     c    uugua 
5'  gg cua uacuguugcuaa  ugcaa ucug     u
    || ||| ||||||||||||  ||||| ||||      
3'  uc ggu gugguaacgauu  acguu aggu     a
   g  a   a            uc     a    uaaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB376606.1: 1626971-1627045 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-367
cli-mir-302b-1KB376606.1: 1626021-1626089 [+]
cli-mir-302cKB376606.1: 1626294-1626381 [+]
cli-mir-302aKB376606.1: 1626446-1626513 [+]
cli-mir-302b-2KB376606.1: 1626801-1626870 [+]
cli-mir-367KB376606.1: 1626971-1627045 [+]
Database links

Mature sequence cli-miR-367-3p

Accession MIMAT0038627
Sequence

47 - 

aauugcacuuuagcaaugguga

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).