Stem-loop sequence cli-mir-365-2

AccessionMI0030036 (change log)
DescriptionColumba livia miR-365-2 stem-loop
Stem-loop
   ---       a        ac   c       -----    u   u 
5'    gcaagaa aaugaggg  uuu aggggca     gcug guu u
      ||||||| ||||||||  ||| |||||||     |||| ||| g
3'    cguucuu uuauuccu  aaa uccccgu     ugac caa c
   uaa       g        aa   -       aauac    c   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375400.1: 348893-348978 [-]
intergenic
Database links

Mature sequence cli-miR-365-2-5p

Accession MIMAT0038626
Sequence

13 - 

agggacuuucaggggcagcugu

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-365-3p

Accession MIMAT0038625
Sequence

53 - 

uaaugccccuaaaaauccuua

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).