Stem-loop sequence cli-mir-218-2

AccessionMI0030021 (change log)
DescriptionColumba livia miR-218-2 stem-loop
Stem-loop
   guu    g        uuu         cu        ------g   ga 
5'    ugug gguuuucc   gugcuugau  aaccaugu       gua  a
      |||| ||||||||   |||||||||  ||||||||       |||   
3'    auac ucggaagg   cacgaacug  uugguaca       cau  c
   cuc    g        uac         uc        agguaaa   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375405.1: 13392676-13392771 [+]
intergenic
Database links

Mature sequence cli-miR-218-5p

Accession MIMAT0038602
Sequence

18 - 

uugugcuugaucuaaccaugu

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-218-3p

Accession MIMAT0038603
Sequence

61 - 

augguucugucaagcaccaug

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).