Stem-loop sequence cli-mir-210

AccessionMI0030014 (change log)
DescriptionColumba livia miR-210 stem-loop
Stem-loop
   ccc   -          g    a   acua       u  ----   u 
5'    ucc aggagcaggu agcc cug    acgcaca ug    ugc c
      ||| |||||||||| |||| |||    ||||||| ||    ||| u
3'    agg uccucgucca ucgg gac    ugcgugu ac    gcg c
   uac   c          a    c   agug       c  cuca   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375641.1: 1057655-1057748 [-]
intergenic
Database links

Mature sequence cli-miR-210-5p

Accession MIMAT0038590
Sequence

18 - 

agccacugacuaacgcacauug

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-210-3p

Accession MIMAT0038591
Sequence

57 - 

cugugcgugugacagcggcuaa

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).