Stem-loop sequence cli-mir-204-3

AccessionMI0030010 (change log)
DescriptionColumba livia miR-204-3 stem-loop
Stem-loop
   ccc      a         ug  a     u    ga  c 
5'    ccugug gcuucccuu  uc uccua gccu  gc a
      |||||| |||||||||  || ||||| ||||  ||  
3'    gggcac cggagggaa  gg agggu cgga  cg u
   guc      c         gu  c     -    gc  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375474.1: 1274454-1274532 [+]
intergenic
Database links

Mature sequence cli-miR-204-5p

Accession MIMAT0038580
Sequence

13 - 

uucccuuugucauccuaugccu

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-204-3-3p

Accession MIMAT0038583
Sequence

49 - 

gcugggacggugaagggaggc

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).