Stem-loop sequence cli-mir-199-1

AccessionMI0030003 (change log)
DescriptionColumba livia miR-199-1 stem-loop
Stem-loop
   aga    -    c   gcc       u        c   ---u   ga 
5'    uccu gcuc guc   ccagugu cagacuac ugu    cag  c
      |||| |||| |||   ||||||| |||||||| |||    |||  a
3'    ggga cggg cag   gguuaca gucugaug aca    guc  a
   aaa    a    u   auu       c        -   uguu   gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375307.1: 10450260-10450353 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-199-1
cli-mir-199-1KB375307.1: 10450260-10450353 [+]
cli-mir-214KB375307.1: 10456129-10456223 [+]
Database links

Mature sequence cli-miR-199-5p

Accession MIMAT0038573
Sequence

18 - 

cccaguguucagacuaccuguuc

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-199-3p

Accession MIMAT0038574
Sequence

56 - 

uacaguagucugcacauugguua

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).