Stem-loop sequence cli-mir-196-3

AccessionMI0030002 (change log)
DescriptionColumba livia miR-196-3 stem-loop
Stem-loop
   gag     cucu      u          a      u    cucc 
5'    aacug    gugguu agguaguuuc uguugu gggg    a
      |||||    |||||| |||||||||| |||||| ||||    c
3'    uugac    cauuaa uccgucaaag acgaca cucu    c
   uag     --uu      u          c      u    cuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB376037.1: 1139776-1139866 [-]
intergenic
Database links

Mature sequence cli-miR-196-5p

Accession MIMAT0038570
Sequence

19 - 

uagguaguuucauguuguuggg

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-196-3-3p

Accession MIMAT0038572
Sequence

56 - 

cuacagcacgaaacugccuuaa

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).