Stem-loop sequence cli-mir-190

AccessionMI0029997 (change log)
DescriptionColumba livia miR-190 stem-loop
Stem-loop
   ucu       u    - ug               ua     uuau 
5'    gcaggac cugu g  auauguuugauauau  gguug    u
      ||||||| |||| |  |||||||||||||||  |||||     
3'    cguccug gaca c  uauacaaacuauaua  ucaac    u
   ucc       u    u cu               --     cuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375367.1: 1114468-1114556 [-]
intergenic
Database links

Mature sequence cli-miR-190-5p

Accession MIMAT0038564
Sequence

17 - 

ugauauguuugauauauuagguu

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-190-3p

Accession MIMAT0038565
Sequence

53 - 

acuauauaucaaacauauuccu

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).