Stem-loop sequence cli-mir-181b-1

AccessionMI0029991 (change log)
DescriptionColumba livia miR-181b-1 stem-loop
Stem-loop
   aaa       aucaa         cug           aa  a 
5'    ggucaca     cauucauug   ucgguggguuu  cu u
      |||||||     |||||||||   |||||||||||  ||  
3'    ccggugu     guaaguaac   agucacucgaa  gg g
   acc       -caac         --a           ca  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375307.1: 7344927-7345011 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-181b-1
cli-mir-181a-1KB375307.1: 7344736-7344835 [+]
cli-mir-181b-1KB375307.1: 7344927-7345011 [+]
Database links

Mature sequence cli-miR-181b-5p

Accession MIMAT0038553
Sequence

14 - 

aacauucauugcugucgguggguu

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-181b-3p

Accession MIMAT0038554
Sequence

54 - 

cucacugaacaaugaaugcaa

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).