Stem-loop sequence cli-mir-153b

AccessionMI0029987 (change log)
DescriptionColumba livia miR-153b stem-loop
Stem-loop
   uua      g      -             gu       -a  aa 
5'    gcgguu ccagug ucauuuuugugau  ugcagcu  gu  u
      |||||| |||||| |||||||||||||  |||||||  ||  a
3'    ugucaa gguuac agugaaaacacug  acguuga  cg  u
   cag      a      u             au       cc  ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375617.1: 193400-193490 [-]
intergenic
Database links

Mature sequence cli-miR-153b-5p

Accession MIMAT0038547
Sequence

16 - 

gucauuuuugugauguugcagcu

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-153b-3p

Accession MIMAT0038548
Sequence

55 - 

uugcauagucacaaaagugaucau

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).