Stem-loop sequence cli-mir-147

AccessionMI0029983 (change log)
DescriptionColumba livia miR-147 stem-loop
Stem-loop
   -  u      u    c   ug   u  c        aaacuugacu    a 
5'  gg acccua gaau uag  gaa ca uucugcac          acug a
    || |||||| |||| |||  ||| || ||||||||          ||||  
3'  uc ugggau uuua auc  cuu gu aaggcgug          ugac a
   c  -      u    c   gu   c  a        ----------    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375982.1: 40089-40180 [+]
intergenic
Database links

Mature sequence cli-miR-147-3p

Accession MIMAT0038541
Sequence

56 - 

gugugcggaaaugcuucugcua

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).