Stem-loop sequence cli-mir-146b

AccessionMI0029981 (change log)
DescriptionColumba livia miR-146b stem-loop
Stem-loop
   cug   a  ug   cug          u       -    aaagc 
5'    gcu cu  gcu   agaacugaau ccauagg cauu     c
      ||| ||  |||   |||||||||| ||||||| ||||      
3'    cga gg  cga   ucuugacuua gguaucc guaa     u
   aaa   c  gu   -cg          -       c    aaauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375604.1: 30533-30621 [+]
intergenic
Database links

Mature sequence cli-miR-146b-5p

Accession MIMAT0038537
Sequence

16 - 

ugagaacugaauuccauaggcauu

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-146b-3p

Accession MIMAT0038538
Sequence

54 - 

ugcccuauggauucaguucugcag

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).