Stem-loop sequence cli-mir-145

AccessionMI0029979 (change log)
DescriptionColumba livia miR-145 stem-loop
Stem-loop
        c        uc    u  c            ua      
5' ccgug ccucaggg  cagu uu ccaggaaucccu  ggcgc 
   ||||| ||||||||  |||| || ||||||||||||  |||| u
3' ggcac ggaguucu  guca aa gguccuuagggg  uugca 
        c        -u    u  a            --      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375668.1: 918669-918752 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-145
cli-mir-143KB375668.1: 918242-918329 [+]
cli-mir-145KB375668.1: 918669-918752 [+]
Database links

Mature sequence cli-miR-145-5p

Accession MIMAT0038533
Sequence

14 - 

guccaguuuucccaggaaucccu

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-145-3p

Accession MIMAT0038534
Sequence

52 - 

ggauuccuggaaauacuguucuu

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).