Stem-loop sequence cli-mir-143

AccessionMI0029978 (change log)
DescriptionColumba livia miR-143 stem-loop
Stem-loop
   ---aug      ag   a  g         g      u  -  aa 
5'       ucuccc  ccc ag ugcagugcu caucuc gg uc  u
         ||||||  ||| || ||||||||| |||||| || ||   
3'       ggaggg  ggg uc augucacga guagag cu ag  u
   cgucaa      aa   c  g         a      u  g  gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375668.1: 918242-918329 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-143
cli-mir-143KB375668.1: 918242-918329 [+]
cli-mir-145KB375668.1: 918669-918752 [+]
Database links

Mature sequence cli-miR-143-5p

Accession MIMAT0038531
Sequence

17 - 

ggugcagugcugcaucucugg

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-143-3p

Accession MIMAT0038532
Sequence

51 - 

ugagaugaagcacuguagcuc

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).