Stem-loop sequence cli-mir-140

AccessionMI0029976 (change log)
DescriptionColumba livia miR-140 stem-loop
Stem-loop
   u  -        -  a             a       uu   uc 
5'  cc guguccug cc gugguuuuacccu ugguagg  acg  a
    || |||||||| || ||||||||||||| |||||||  |||   
3'  gg cguagggc gg caccaagauggga accaucu  ugu  u
   -  u        a  -             c       --   cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375448.1: 5480462-5480545 [-]
intergenic
Database links

Mature sequence cli-miR-140-5p

Accession MIMAT0038527
Sequence

13 - 

cagugguuuuacccuaugguag

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-140-3p

Accession MIMAT0038528
Sequence

53 - 

accacaggguagaaccacggac

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).