Stem-loop sequence cli-mir-135-3

AccessionMI0029970 (change log)
DescriptionColumba livia miR-135-3 stem-loop
Stem-loop
   ua  -      g     --              au          -   cu 
5'   ag cccucu cugug  guuuauggcuuuuu  uccuauguga uug  u
     || |||||| |||||  ||||||||||||||  |||||||||| |||  u
3'   uc gggagg gacac  cggguaccgaaaag  gggauguacu aau  u
   cc  a      a     au              -c          c   cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375465.1: 178788-178887 [+]
intergenic
Database links

Mature sequence cli-miR-135-5p

Accession MIMAT0038514
Sequence

20 - 

uauggcuuuuuauuccuauguga

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-135-3-3p

Accession MIMAT0038517
Sequence

59 - 

auguagggcgaaaagccauggg

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).