Stem-loop sequence cli-mir-130a

AccessionMI0029962 (change log)
DescriptionColumba livia miR-130a stem-loop
Stem-loop
   ---   u             u          a  ---g   au 
5'    cug ccagugcccuuuu auguuguacu cu    gug  c
      ||| ||||||||||||| |||||||||| ||    |||   
3'    gac gguuacgggaaaa uguaacguga ga    cac  a
   aac   c             u          c  aaaa   gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375855.1: 630666-630747 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-130a
cli-mir-130aKB375855.1: 630666-630747 [+]
cli-mir-301aKB375855.1: 631245-631328 [+]
Database links

Mature sequence cli-miR-130a-5p

Accession MIMAT0038505
Sequence

10 - 

gcccuuuuuauguuguacuacu

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-130a-3p

Accession MIMAT0038506
Sequence

51 - 

cagugcaauguuaaaagggcau

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).