Stem-loop sequence cli-mir-128-1

AccessionMI0029959 (change log)
DescriptionColumba livia miR-128-1 stem-loop
Stem-loop
   ----    u      uuc       uaa      cu       u 
5'     gagc guugga   ggggccg   cacugu  gagaggu u
       |||| ||||||   |||||||   ||||||  |||||||  
3'     uucg cgacuu   cucuggc   gugaca  cucuuua a
   gucc    u      uuu       caa      --       c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375634.1: 1216448-1216531 [+]
intergenic
Database links

Mature sequence cli-miR-128-3p

Accession MIMAT0038501
Sequence

49 - 

ucacagugaaccggucucuuu

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).