Stem-loop sequence cli-mir-103-1

AccessionMI0029949 (change log)
DescriptionColumba livia miR-103-1 stem-loop
Stem-loop
   u u    c       --    u  u           c   u g a 
5'  g cuua ugucuuc  ggcu cu uacagugcugc uug u c u
    | |||| |||||||  |||| || ||||||||||| ||| | |  
3'  c gagu acggaag  ucgg ga auguuacgacg aac a g a
   u u    u       ua    -  c           -   u g u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375405.1: 13537698-13537785 [+]
intergenic
Database links

Mature sequence cli-miR-103-3p

Accession MIMAT0038485
Sequence

53 - 

agcagcauuguacagggcuauga

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).