Stem-loop sequence cli-mir-100-1

AccessionMI0029946 (change log)
DescriptionColumba livia miR-100-1 stem-loop
Stem-loop
   ----gc   u -uu c    a   cg     c   a      guca 
5'       gcc g   g caca acc  uagau cga cuugug    u
         ||| |   | |||| |||  ||||| ||| ||||||    a
3'       cgg c   c gugu ugg  aucua guu gaacac    u
   cgugaa   u ugu u    a   au     u   c      accu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375651.1: 869665-869754 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-100-1
cli-mir-100-1KB375651.1: 869665-869754 [-]
cli-let-7a-2KB375651.1: 862705-862784 [-]
Database links

Mature sequence cli-miR-100-5p

Accession MIMAT0038480
Sequence

16 - 

aacccguagauccgaacuugug

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-100-3p

Accession MIMAT0038481
Sequence

51 - 

caagcuuguaucuauagguaug

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).