Stem-loop sequence cli-mir-34c

AccessionMI0029941 (change log)
DescriptionColumba livia miR-34c stem-loop
Stem-loop
   auc     ag     a   a    a     c      ccaa 
5'    agccu  uuacu ggc gugu guuag ugauug    a
      |||||  ||||| ||| |||| ||||| ||||||     
3'    ucgga  aaugg ccg caca cgauc acuaac    a
   ggu     aa     a   a    c     -      caug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375352.1: 2053395-2053477 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-34c
cli-mir-34bKB375352.1: 2053022-2053108 [+]
cli-mir-34cKB375352.1: 2053395-2053477 [+]
Database links

Mature sequence cli-miR-34c-5p

Accession MIMAT0038471
Sequence

16 - 

aggcaguguaguuagcugauugc

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-34c-3p

Accession MIMAT0038472
Sequence

49 - 

aaucacuagccacacagccagg

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).