Stem-loop sequence cli-mir-34a

AccessionMI0029939 (change log)
DescriptionColumba livia miR-34a stem-loop
Stem-loop
    ug     uu        -   a          ---g   gc 
5' g  uuucu  ggcagugu cuu gcugguuguu    uga  a
   |  |||||  |||||||| ||| ||||||||||    |||  a
3' c  gaaga  ccgucaua gaa cgacuaacga    acu  u
    gu     uc        u   -          agga   ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB376210.1: 1562316-1562397 [+]
intergenic
Database links

Mature sequence cli-miR-34a-5p

Accession MIMAT0038467
Sequence

10 - 

uggcagugucuuagcugguugu

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-34a-3p

Accession MIMAT0038468
Sequence

53 - 

caaucagcaaguauacugcccu

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).