Stem-loop sequence cli-mir-33-2

AccessionMI0029938 (change log)
DescriptionColumba livia miR-33-2 stem-loop
Stem-loop
   ccc         g   g     u    uu         gug  ag 
5'    ggcccucgc ggg ugcau guag  gcauugcau   uc  a
      ||||||||| ||| ||||| ||||  |||||||||   ||   
3'    ccgggggcg ccc acgua cguc  cguaacgug   gg  c
   gcc         g   g     c    cc         --a  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375439.1: 1338929-1339018 [+]
intergenic
Database links

Mature sequence cli-miR-33-5p

Accession MIMAT0038464
Sequence

17 - 

gugcauuguaguugcauugca

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-33-2-3p

Accession MIMAT0038466
Sequence

56 - 

caaugccccugccaugcagcc

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).