Stem-loop sequence cli-mir-32

AccessionMI0029936 (change log)
DescriptionColumba livia miR-32 stem-loop
Stem-loop
   u  g   -    -          u           -  uu  c 
5'  cu gug gaga uauugcacau acuaaguugca ug  gu a
    || ||| |||| |||||||||| ||||||||||| ||  ||  
3'  ga uac cuuu auagcgugug ugauuuaacgu ac  cg c
   u  g   a    c          -           g  uc  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375503.1: 729037-729120 [-]
intergenic
Database links

Mature sequence cli-miR-32-5p

Accession MIMAT0038462
Sequence

12 - 

uauugcacauuacuaaguugca

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-32-3p

Accession MIMAT0038463
Sequence

53 - 

caauuuagugugugcgauacu

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).