Stem-loop sequence cli-mir-30c-2

AccessionMI0029932 (change log)
DescriptionColumba livia miR-30c-2 stem-loop
Stem-loop
   uga    uacu       u   aca         ----gu g 
5'    cagg    guaaaca ccu   cucucagcu      g a
      ||||    ||||||| |||   |||||||||      |  
3'    gucc    cauuugu gga   gagggucga      c a
   -cc    cucu       c   --a         aagaau a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375528.1: 5128891-5128969 [+]
intergenic
Database links

Mature sequence cli-miR-30c-5p

Accession MIMAT0038453
Sequence

11 - 

uguaaacauccuacacucucagcu

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-30c-2-3p

Accession MIMAT0038455
Sequence

51 - 

cugggagaaggcuguuuacucu

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).