Stem-loop sequence cli-mir-30a

AccessionMI0029930 (change log)
DescriptionColumba livia miR-30a stem-loop
Stem-loop
   -  a   a            uc           g gaagc 
5'  ug gcg cuguaaacaucc  gacuggaagcu u     a
    || ||| ||||||||||||  ||||||||||| |      
3'  ac cgu gacguuuguagg  cugacuuucgg g     g
   a  -   c            --           g uagac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375528.1: 5103425-5103502 [+]
intergenic
Database links

Mature sequence cli-miR-30a-5p

Accession MIMAT0038451
Sequence

9 - 

uguaaacauccucgacuggaagcu

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-30a-3p

Accession MIMAT0038452
Sequence

51 - 

cuuucagucggauguuugcagc

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).