Stem-loop sequence cli-mir-23b

AccessionMI0029922 (change log)
DescriptionColumba livia miR-23b stem-loop
Stem-loop
     u        u   --          -  a      gugacu 
5' gu guggcugu ugg  guuccuggca ug ugauuu      u
   || |||||||| |||  |||||||||| || ||||||       
3' ca uaccgaca acc  uagggaccgu ac acuaaa      a
     u        c   au          u  -      auuaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375520.1: 156759-156842 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-23b
cli-mir-23bKB375520.1: 156759-156842 [+]
cli-mir-27bKB375520.1: 156995-157076 [+]
Database links

Mature sequence cli-miR-23b-5p

Accession MIMAT0038440
Sequence

13 - 

uggguuccuggcaugaugauuu

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-23b-3p

Accession MIMAT0038441
Sequence

51 - 

aucacauugccagggauuaccaca

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).