Stem-loop sequence cli-mir-22

AccessionMI0029921 (change log)
DescriptionColumba livia miR-22 stem-loop
Stem-loop
   cag  c           -     a      u  -c  u 
5'    ca caguucuucag uggca gcuuua gu  cu c
      || ||||||||||| ||||| |||||| ||  || u
3'    gu gucaagaaguu accgu cgaaau cg  ga c
   uaa  u           g     -      -  au  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375376.1: 2621547-2621621 [-]
intergenic
Database links

Mature sequence cli-miR-22-5p

Accession MIMAT0038438
Sequence

8 - 

aguucuucaguggcaagcuuua

 - 29

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-22-3p

Accession MIMAT0038439
Sequence

49 - 

aagcugccaguugaagaacugu

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).