Stem-loop sequence cli-mir-19a

AccessionMI0029915 (change log)
DescriptionColumba livia miR-19a stem-loop
Stem-loop
   uuu    u  u                 --      ---    ag 
5'    gcag cu cuguuaguuuugcauag  uugcac   uaca  a
      |||| || |||||||||||||||||  ||||||   ||||  a
3'    uguc gg gguagucaaaacguauc  aacgug   augu  g
   uau    c  u                 ua      uug    ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375488.1: 2837667-2837754 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-19a
cli-mir-17KB375488.1: 2837957-2838047 [-]
cli-mir-18aKB375488.1: 2837808-2837898 [-]
cli-mir-19aKB375488.1: 2837667-2837754 [-]
cli-mir-20aKB375488.1: 2837493-2837575 [-]
cli-mir-19b-1KB375488.1: 2837364-2837438 [-]
cli-mir-92-1KB375488.1: 2837243-2837324 [-]
Database links

Mature sequence cli-miR-19a-5p

Accession MIMAT0038427
Sequence

14 - 

guuaguuuugcauaguugcacua

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-19a-3p

Accession MIMAT0038428
Sequence

52 - 

ugugcaaaucuaugcaaaacuga

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).