Stem-loop sequence cli-mir-16a-1

AccessionMI0029909 (change log)
DescriptionColumba livia miR-16a-1 stem-loop
Stem-loop
   ucu   a              -  a        u uuaagac 
5'    guc uacuuuagcagcac gu aauauugg g       u
      ||| |||||||||||||| || |||||||| |        
3'    cgg augaagucgucgug ca uuaugacc c       g
   gau   a              u  a        u uauaaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375372.1: 15185451-15185535 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-16a-1
cli-mir-15aKB375372.1: 15185597-15185675 [-]
cli-mir-16a-1KB375372.1: 15185451-15185535 [-]
Database links

Mature sequence cli-miR-16a-5p

Accession MIMAT0038416
Sequence

13 - 

uagcagcacguaaauauuggugu

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-16a-3p

Accession MIMAT0038417
Sequence

52 - 

uccaguauuaacugugcugcugaa

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).