Stem-loop sequence cli-mir-10a

AccessionMI0029903 (change log)
DescriptionColumba livia miR-10a stem-loop
Stem-loop
   cuu        a    g     c          uaaagg 
5'    cuauaugu cccu uagau cgaauuugug      a
      |||||||| |||| ||||| ||||||||||      a
3'    gauguaua gggg aucua gcuuaaacac      g
   guu        a    -     u          uggguu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375599.1: 1564483-1564562 [+]
intergenic
Database links

Mature sequence cli-miR-10a-5p

Accession MIMAT0038404
Sequence

11 - 

uacccuguagauccgaauuugug

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-10a-3p

Accession MIMAT0038405
Sequence

51 - 

caaauucguaucuaggggaaua

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).