Stem-loop sequence cli-mir-7b

AccessionMI0029899 (change log)
DescriptionColumba livia miR-7b stem-loop
Stem-loop
   cau   c       cu   a    u u     --    -      aau 
5'    ccc gggcagg  gga gacu g gauuu  uguu guuucc   g
      ||| |||||||  ||| |||| | |||||  |||| ||||||   u
3'    ggg cccgucc  ccu cuga c cuaaa  acaa cgaggg   c
   cac   c       cu   -    c -     ca    g      caa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB376649.1: 107537-107630 [-]
intergenic
Database links

Mature sequence cli-miR-7b-5p

Accession MIMAT0038400
Sequence

16 - 

uggaagacuugugauuuuguuguu

 - 39

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).