Stem-loop sequence cli-mir-7a-3

AccessionMI0029898 (change log)
DescriptionColumba livia miR-7a-3 stem-loop
Stem-loop
   ggu       cu   c    a  a   g      u      -  gauu 
5'    ggucugg  cug gugg ag cua ugauuu guuguu cu    u
      |||||||  ||| |||| || ||| |||||| |||||| ||     
3'    ccagacc  gac cacc uc gau acuaaa caacag gg    a
   cgu       -c   c    g  c   -      -      u  aaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375415.1: 436058-436151 [+]
intergenic
Database links

Mature sequence cli-miR-7a-5p

Accession MIMAT0038396
Sequence

18 - 

uggaagacuagugauuuuguuguu

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-7a-3-3p

Accession MIMAT0038399
Sequence

59 - 

caacaaaucauagccugccacc

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).