Stem-loop sequence cli-let-7f

AccessionMI0029890 (change log)
DescriptionColumba livia let-7f stem-loop
Stem-loop
   --uu     u   a ug                      ---------       u 
5'     cucug cag g  agguaguagauuguauaguugu         aggguag u
       ||||| ||| |  ||||||||||||||||||||||         ||||||| a
3'     gaggc guc c  uccguuaucuaacauaucaaua         ucccauu u
   aaau     -   - cu                      gaggacuug       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375849.1: 22603-22704 [+]
intergenic
Clustered miRNAs
< 10kb from cli-let-7f
cli-let-7a-1KB375849.1: 22163-22253 [+]
cli-let-7fKB375849.1: 22603-22704 [+]
cli-let-7dKB375849.1: 23611-23697 [+]
Database links

Mature sequence cli-let-7f-5p

Accession MIMAT0038385
Sequence

14 - 

ugagguaguagauuguauaguu

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-let-7f-3p

Accession MIMAT0038386
Sequence

70 - 

cuauacaaucuauugccuuccc

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).