Stem-loop sequence cli-let-7a-4

AccessionMI0029885 (change log)
DescriptionColumba livia let-7a-4 stem-loop
Stem-loop
   ---   u          gu         ---ugg  gg -       
5'    agg gagguaguag  uguauaguu      ug  a gggauu 
      ||| ||||||||||  |||||||||      ||  | ||||| u
3'    ucc uuccguuauc  acauaucaa      ac  u cccuag 
   aau   -          ug         uagugg  uu a       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375734.1: 1197811-1197895 [-]
intergenic
Clustered miRNAs
< 10kb from cli-let-7a-4
cli-let-7eKB375734.1: 1198016-1198108 [-]
cli-let-7a-4KB375734.1: 1197811-1197895 [-]
Database links

Mature sequence cli-let-7a-5p

Accession MIMAT0038374
Sequence

4 - 

ugagguaguagguuguauaguu

 - 25

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-let-7a-4-3p

Accession MIMAT0038377
Sequence

61 - 

cuauacagucuauugccuuccu

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).