Stem-loop sequence cli-let-7a-3

AccessionMI0029884 (change log)
DescriptionColumba livia let-7a-3 stem-loop
Stem-loop
   guc   ug   u   gu                ---------u        
5'    cuu  ggg gag  aguagguuguauaguu          uagggcu 
      |||  ||| |||  ||||||||||||||||          |||||| c
3'    gaa  ccu uuc  ucaucuaacauaucaa          gucccgu 
   ggu   gu   -   ug                uacacugucc        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375672.1: 360757-360847 [-]
intergenic
Clustered miRNAs
< 10kb from cli-let-7a-3
cli-let-7a-3KB375672.1: 360757-360847 [-]
cli-let-7bKB375672.1: 359882-359981 [-]
Database links

Mature sequence cli-let-7a-5p

Accession MIMAT0038374
Sequence

12 - 

ugagguaguagguuguauaguu

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-let-7a-3p

Accession MIMAT0038375
Sequence

62 - 

cuauacaaucuacugucuuuc

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).