Stem-loop sequence cli-let-7a-1

AccessionMI0029882 (change log)
DescriptionColumba livia let-7a-1 stem-loop
Stem-loop
   cugug  g     u   gu                uuagg   aua    c 
5'      cu uggga gag  aguagguuguauaguu     guc   cccg a
        || ||||| |||  ||||||||||||||||     |||   ||||  
3'      ga auccu uuc  ucaucuaacauaucaa     uag   gggu a
   -----  a     -   ug                -----   --a    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375849.1: 22163-22253 [+]
intergenic
Clustered miRNAs
< 10kb from cli-let-7a-1
cli-let-7a-1KB375849.1: 22163-22253 [+]
cli-let-7fKB375849.1: 22603-22704 [+]
cli-let-7dKB375849.1: 23611-23697 [+]
Database links

Mature sequence cli-let-7a-5p

Accession MIMAT0038374
Sequence

14 - 

ugagguaguagguuguauaguu

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-let-7a-3p

Accession MIMAT0038375
Sequence

65 - 

cuauacaaucuacugucuuuc

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).