Stem-loop sequence ami-mir-9612

AccessionMI0029879 (change log)
DescriptionAlligator mississippiensis miR-9612 stem-loop
Stem-loop
   ----ac      g  a                         uuc   u 
5'       gaagca gu uacuuaacuucugcucuucuuucau   aug c
         |||||| || |||||||||||||||||||||||||   ||| u
3'       cuucgu ca augaguugaggaugggaagaaagua   uac a
   ugucua      a  c                         ccu   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03002956.1: 26838108-26838202 [+]
intergenic
Database links

Mature sequence ami-miR-9612-5p

Accession MIMAT0038368
Sequence

16 - 

uuaacuucugcucuucuuuca

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-9612-3p

Accession MIMAT0038369
Sequence

58 - 

aaagaaggguaggaguugagua

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).