Stem-loop sequence ami-mir-9610

AccessionMI0029877 (change log)
DescriptionAlligator mississippiensis miR-9610 stem-loop
Stem-loop
   uaa   u         uaacu      a    caugu  a 
5'    ccu gugugacag     ccuucu ggaa     gc u
      ||| |||||||||     |||||| ||||     || c
3'    gga cacacuguc     ggagga ccuu     cg c
   aaa   c         -uguc      -    ----u  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03005076.1: 302363-302439 [+]
intergenic
Database links

Mature sequence ami-miR-9610-5p

Accession MIMAT0038364
Sequence

9 - 

ugugacaguaacuccuucuagg

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-9610-3p

Accession MIMAT0038365
Sequence

50 - 

ccaggaggcugucugucacacca

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).