Stem-loop sequence ami-mir-9609

AccessionMI0029876 (change log)
DescriptionAlligator mississippiensis miR-9609 stem-loop
Stem-loop
   cuguguu    g  ag      -cu       ca    u 
5'        gccu ug  uccaug   cagcucu  uguu c
          |||| ||  ||||||   |||||||  |||| u
3'        cgga ac  agguac   gucgggg  acga c
   ----ucu    a  ga      cuc       ac    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03002077.1: 1358377-1358452 [+]
intergenic
Clustered miRNAs
< 10kb from ami-mir-9609
ami-mir-142-1AKHW03002077.1: 1358126-1358212 [+]
ami-mir-9609AKHW03002077.1: 1358377-1358452 [+]
Database links

Mature sequence ami-miR-9609-5p

Accession MIMAT0038362
Sequence

14 - 

gaguccaugcucagcucucaug

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-9609-3p

Accession MIMAT0038363
Sequence

47 - 

caggggcugcuccauggaagca

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).