Stem-loop sequence ami-mir-9608

AccessionMI0029875 (change log)
DescriptionAlligator mississippiensis miR-9608 stem-loop
Stem-loop
   ca gu     c g     a  cu           g a 
5'   g  cccuu u guucu ca  ucuaugauucu u a
     |  ||||| | ||||| ||  ||||||||||| |  
3'   c  gggaa g uaaga gu  ggauacuaagg g a
   ga ug     c g     g  uc           g a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03002956.1: 4146963-4147038 [-]
intergenic
Database links

Mature sequence ami-miR-9608-5p

Accession MIMAT0038360
Sequence

13 - 

gguucuacacuucuaugauucu

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-9608-3p

Accession MIMAT0038361
Sequence

45 - 

aaucauaggcuuggagaauggca

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).