Stem-loop sequence ami-mir-9600

AccessionMI0029867 (change log)
DescriptionAlligator mississippiensis miR-9600 stem-loop
Stem-loop
                                a   ---c    ga 
5' gguugggagagguuuuagacaagcuguug gcc    agug  a
   ||||||||||||||||||||||||||||| |||    ||||   
3' ccaacccucucuaaaaucuguuugauaac cgg    ucac  g
                                -   uacu    ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03001467.1: 14436142-14436225 [-]
intergenic
Database links

Mature sequence ami-miR-9600-5p

Accession MIMAT0038344
Sequence

14 - 

uuuagacaagcuguugagcccag

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-9600-3p

Accession MIMAT0038345
Sequence

51 - 

auggccaauaguuugucuaaaau

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).