Stem-loop sequence ami-mir-9598

AccessionMI0029865 (change log)
DescriptionAlligator mississippiensis miR-9598 stem-loop
Stem-loop
   cuuccc       -         -          au        g 
5'       uucuccc cccccuuuc aaaauucuag  cugccuau g
         ||||||| ||||||||| ||||||||||  ||||||||  
3'       gggaggg gggggaaag uuuuaggauc  gaugggua g
   ---cac       u         g          au        c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03005564.1: 1774355-1774441 [+]
intergenic
Database links

Mature sequence ami-miR-9598-5p

Accession MIMAT0038340
Sequence

18 - 

cuuucaaaauucuagaucugcc

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-9598-3p

Accession MIMAT0038341
Sequence

52 - 

uaguacuaggauuuuggaaaggg

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).