Stem-loop sequence ami-mir-3064

AccessionMI0029863 (change log)
DescriptionAlligator mississippiensis miR-3064 stem-loop
Stem-loop
   guu       --g     ---gc     ug     -     cuuu  g 
5'    uaucuuu   auuug     uguug  gugug caaaa    gu c
      |||||||   |||||     |||||  ||||| |||||    || g
3'    guagaag   uagac     acaac  cacac guuuu    cg u
   agu       gug     auuuc     gu     c     ---u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03004113.1: 4254715-4254804 [+]
intergenic
Database links

Mature sequence ami-miR-3064-3p

Accession MIMAT0038338
Sequence

52 - 

uugccacacugcaacacuuuac

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).