Stem-loop sequence ami-mir-2188

AccessionMI0029860 (change log)
DescriptionAlligator mississippiensis miR-2188 stem-loop
Stem-loop
   --     u   -a  c      a     ca   u  c       guaug  a 
5'   gaaua cag  cc guggga agguc  acc ca auguccu     uc c
     ||||| |||  || |||||| |||||  ||| || |||||||     ||  
3'   cuuau guc  gg cacccu uccag  ugg gu uauaggg     gg g
   uu     -   cc  a      a     ac   u  a       ----a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03001890.1: 9735-9832 [+]
intergenic
Database links

Mature sequence ami-miR-2188-5p

Accession MIMAT0038333
Sequence

20 - 

aagguccaaccucacaugucc

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-2188-3p

Accession MIMAT0038334
Sequence

59 - 

auauauguggucagaccuauc

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).